ParvoDB ID PV026262 GenBank Accession EF121420
Subfamily Parvovirinae Genus Erythroparvovirus
Species Erythroparvovirus primate1 Sequence Length 237
Definition Human parvovirus B19 isolate R1 minor capsid protein (VP1) gene, partial cds. Submission Date 2006-11-15
Strain Name R1 Sampling Date 2003
Sampling Country Tunisia Location Tunisia
Submitted By Regaya,F., Khelifa,R., Bejaoui,M. and Karoui,M. Submitting Institution Laboratory, Hopital Habib Thameur, Abdelaziz Laroui, Tunis 1008, Tunisia
Original Host Human Sample Type Sera samples
Standardized Host Name Homo sapiens Host Tax Rank species
Standardized Host Class Mammalia Standardized Host Order Primates
Environmental Origin - N/A - Reagent Origin - N/A -
Number Reagent/Consumables Purpose PMID/Url Reference
1 Specific enzyme immunoassays (Biotrin International, France) To detect anti-Parvovirus IgG and IgM in sera 17961236 View Related Publication
2 LP 200 microplate reader (Diagnostic Pasteur, France) To read the colorimetric reaction in enzyme immunoassays
3 Proteinase K For digestion of sera to extract DNA
4 QIAamp DNA Blood kit (Qiagen, Hilden, Germany) To extract DNA from serum samples
5 Outer primers (CAAAAGCATGTGGAGTGAGG, CTACTAACATGCATAGGCGC) For the first round of nested PCR for B19 DNA detection
6 Inner primers (CCCAGAGCACCATTATAAGG, GTGCTGTCAGTAACCTGTAC) For the second round of nested PCR for B19 DNA detection
7 Taq DNA polymerase (Promega) For DNA amplification in PCR reactions
8 Molecular weight marker (100 bp ladder, Invitrogen) For estimating the size of PCR amplicons during agarose gel electrophoresis
9 QIAquick spin columns (Qiagen, Hilden, Germany) To purify nested PCR products from agarose gel bands
10 Taq Dideoxy Terminator cycle sequencing kit For sequencing the purified DNA
11 ABI Prism 377 DNA sequencer (Applied Biosystems) To perform DNA sequencing