ParvoDB ID PV013011 GenBank Accession OR536298
Subfamily Parvovirinae Genus Protoparvovirus
Species Protoparvovirus primate3 Sequence Length 387
Definition Cutavirus isolate F335 VP2 gene, partial cds. Submission Date 2023-09-08
Strain Name F335 Sampling Date 2021-11-18
Sampling Country China Location Guangzhou, Guangdong, China
Submitted By Li,Y. Submitting Institution School of Public Health, Southern Medical University, Guangzhou North Road, Guangzhou, Guang Dong 510515, China
Original Host Homo sapiens Sample Type Fecal sample
Standardized Host Name Homo sapiens Host Tax Rank species
Standardized Host Class Mammalia Standardized Host Order Primates
Environmental Origin - N/A - Reagent Origin - N/A -
Number Reagent/Consumables Purpose PMID/Url Reference
1 Fresh stools Collected from study participants for DNA testing. 37839551 View Related Publication
2 Phosphate buffer saline Used to create a 20% stool suspension for fecal sample processing.
3 GoTaq Green Master Mix amplification kit (Promega, USA) Used for conducting nested PCR for screening the VP2 partial gene region.
4 Outer forward primer: 5'-3361CAAACTACCAACTTACTGCTACCA3384-3' Used for the first round of nested PCR amplification.
5 Outer reversed primer: 5'-3834GTTAGTCTGGTTCCTTCAGTTG3858-3' Used for the first round of nested PCR amplification.
6 Inner forward primer: 5'-3397GAATACAATAGACATAAACCAAGCAGAC3424-3' Used for the second round of nested PCR amplification.
7 Inner reversed primer: 5'-3801TGCTTGTGAAAATGAACTGCCTG3823-3' Used for the second round of nested PCR amplification.
8 1% agarose gel Used for identifying PCR products through gel electrophoresis.
9 Phosphate-buffered saline Used to dilute stool samples before DNA extraction.
10 ABI PRISM 3730XL DNA Analyzer (Applied Biosystems) Used for sequencing PCR fragments for phylogenetic analysis.