ParvoDB ID PV009572 GenBank Accession AM849113
Subfamily Parvovirinae Genus Bocaparvovirus
Species Bocaparvovirus primate1 Sequence Length 394
Definition Human bocavirus 144/01/2002/FRA partial VP1 gene. Submission Date 2007-08-22
Strain Name 144/01/2002/FRA Sampling Date 2002-01
Sampling Country France Location University Medical Hospital Center of Reims,Champagne-Ardenne, France
Submitted By Jacques,J. Submitting Institution Jacques J., Laboratoire de virologie, CHU Robert Debre IFR53, rue du general Koenig 51092 Reims Cedex, 51092, FRANCE
Original Host None Sample Type nasopharyngeal aspirate samples
Standardized Host Name Homo sapiens Host Tax Rank species
Standardized Host Class Mammalia Standardized Host Order Primates
Environmental Origin - N/A - Reagent Origin - N/A -
Number Reagent/Consumables Purpose PMID/Url Reference
1 Sterile physiological saline fluid Collection of nasopharyngeal secretions 18644746 View Related Publication
2 Disposable mucus extractor Collection of nasopharyngeal secretions
3 Monoclonal antibodies (Argene Biosoft, Varhiles, France) Immunofluorescence assays for viral antigen detection
4 Standard viral transport medium Dilution of nasopharyngeal secretion specimen
5 Continuous human diploid fibroblasts (MRC-5) and Rhesus monkey kidney (MA-104) cells Viral cell-culture detection
6 Immunofluorescence antigen detection assays reagents Typing of virus isolates in infected cell monolayers
7 High Pure Viral Nucleic Acid Kit (Roche Diagnostics, Mannheim, Germany) Extraction of total nucleic acids
8 Diethyl-pyrocarbonate (DEPC) sterile water Elution and storage of nucleic acids
9 iQTMSYBR Green Supermix 2X (Bio-Rad, Marnes-la-coquette, France) Real-time PCR reactions
10 Primers HBoV-F (TATGGCCAAGGCAATCGTCCAAG) and HBoV-R (GCCGCCTGAACATGAGAAACAGA) Ampli?cation of a 291-bp fragment of HBoV NS-1 gene in real-time PCR
11 TaqMan GAPDH Control Reagents (Applied Biosystem, Courtaboeuf, France) Quantitative detection of GAPDH for normalization in real-time PCR
12 Primers for VP1/VP2 genes and PCR amplification reagents Amplification of a 404-bp fragment of HBoV VP1 and VP2 genes
13 DNA sequencing reagents (Applied Biosystems) and ABI 3130 Sequencer Sequencing of VP1/VP2 gene PCR products