Panoramic Parvovirus Strain Discovery Data Chain

Download Strain's Sequence
Feedback for This Record
ParvoDB ID PV001570 GenBank Accession OK149188
Subfamily Parvovirinae Genus Erythroparvovirus
Species Erythroparvovirus primate1 Sequence Length 843
Definition Human parvovirus B19 isolate Bushehr-PW9 NS1 protein and minor capsid protein VP1 genes, partial cds. Submission Date 2021-09-15
Strain Name B19 Sampling Date from 2018-01 to 2019-06
Sampling Country Iran Location cities of Bushehr, Borazjan, Jam, Khormuj, and Ahram in southern Iran, Iran
Submitted By Farshadpour,F. and Taherkhani,R. Submitting Institution Department of Virology, Bushehr University of Medical Sciences, Moallem St., Bushehr 7514633341, Iran
Original Host Homo sapiens Sample Type serum samples
Standardized Host Name Homo sapiens Host Tax Rank species
Standardized Host Class Mammalia Standardized Host Order Primates
Environmental Origin - N/A - Reagent Origin - N/A -
Number Reagent/Consumables Purpose PMID/Url Reference
1 Commercially available ELISA kits (Euroimmun, Lübeck, Germany) To test for the presence of anti-parvovirus B19 IgM and anti-parvovirus B19 IgG in serum samples. 35483391 View Related Publication
2 High Pure Viral Nucleic Acid kit (Roche, Mannheim, Germany) To extract parvovirus B19 DNA from serum samples.
3 Outer primers (forward primer B19F-1: CACTATGAAAACTGGGCAATAAAC; reverse primer B19R-1: CCAGGCTTGTGTAAGTCTTC) To amplify the 945-bp-length fragments of the human parvovirus B19 genome from NS1 through VP1u via nested PCR.
4 Inner primers (forward primer B19FF-2: AAACTGGGCAATAAACTACACTTTTGA; reverse primer B19RR-2: ACTGYTACTGGATGATAAGGCA) To amplify the 878-bp-length fragments of the human parvovirus B19 genome from NS1 through VP1u via nested PCR.
5 Human parvovirus B19-positive serum sample To use as the positive control for the PCR assay.
6 PCR-grade water To use as the negative control for the PCR assay.